Nuclear proteins interacting with an AP-1/CRE-like promoter sequence in the human TNF$\alpha$ gene

Monocyte developmental heterogeneity is reflected at the cellular level by differential activation competence, at the molecular level by differential regulation of gene expression. LPS activates monocytes to produce tumor necrosis factor-$\alpha$ (TNF). Events occurring at the molecular level necessary for TNF regulation have not been elucidated, but depend both on activation signals and the maturation state of the cell: Peripheral blood monocytes produce TNF upon LPS stimulation, but only within the first 72 hours of culture. Expression of c-fos is associated with monocytic differentiation and activation; the fos-associated protein, c-jun, is also expressed during monocyte activation. Increased cAMP levels are associated with down regulation of macrophage function, including LPS-induced TNF transcription. Due to these associations, we studied a region of the TNF promoter which resembles the binding sites for both AP-1(fos/jun) and CRE-binding protein (or ATF) in order to identify potential molecular markers defining activation competent populations of monocytic cells.^ Nuclear protein binding studies using extracts from THP-1 monocytic cells stimulated with LPS, which stimulates, or dexamethasone (Dex) or pentoxyfilline (PTX), which inhibit TNF production, respectively, suggest that a low mobility doublet complex may be involved in regulation through this promoter region. PTX or Dex increase binding of these complexes equivalently over untreated cells; approximately two hours after LPS induction, the upper complex is undetectable. The upper complex is composed of ATF2 (CRE-BP1); the lower is a heterodimer of jun/ATF2. LPS induces c-jun and thus may enhance formation of jun-ATF2 complexes. The simultaneous presence of both complexes may reduce the amount of TNF transcription through competitive binding, while a loss of the upper (ATF2) and/or gain of the lower (jun-ATF2) allow increased transcription. AP-1 elements generally transduce signals involving PKC; the CRE mediates a cAMP response, involving PKA. Thus, this element has the potential of receiving signals through divergent signalling pathways. Our findings also suggest that cAMP-induced inhibition of macrophage functions may occur via down regulation of activation-associated genes through competitive binding of particular cAMP-responsive nuclear protein complexes. ^

Targeting dysregulated nuclear proteins androgen receptor and enhancer of zeste homolog 2: Clinical implication and mechanism underline

Cancer is the most devastating disease that has tremendous impacts on public health. Many efforts have been devoted to fighting cancer through either translational or basic researches for years. Nowadays, it emerges the importance to converge these two research directions and complement to each other for battling with cancer. Thus, our study aims at both translational and basic research directions. The first goal of our study is focus on translational research to search for new agents targeting prevention and therapy of advanced prostate cancer. Hormone refractory prostate cancer is incurable and lethal. Androgen receptor (AR) mediates androgen's effect not only on the tumor initiation but also plays the major role in the relapse transition of prostate cancer. Here we demonstrate that emodin, a natural compound, can directly target AR to suppress prostate cancer cell growth in vitro and prolong the survival of C3(1)/SV40 transgenic mice in vivo. Emodin treatment resulted in repressing androgen-dependent transactivation of AR by inhibiting AR nuclear translocation. Emodin decreased the association of AR and heat shock protein 90 and increased the association of AR and MDM2, which in turn, induces AR degradation through a proteasome-mediated pathway in a ligand independent manner. Our work indicates a new mechanism for the emodin-mediated anticancer effect and justifies further investigation of emodin as a therapeutic and preventive agent for prostate cancer. The second goal of our study is try to elucidate the fundamental tumor biology of cancer progression then provide the rationale to develop more efficient therapeutic strategy. Enhancer of zeste homologue 2 (EZH2) plays an important role in many biological processes through its intrinsic methyltransferase activity to trimethylate lysine 27 in histone H3. Although overexpression of EZH2 has been shown to be involved in cancer progression, the detailed mechanisms are elusive. Here, we show that Akt phosphorylates EZH2 at serine 21 and suppresses its methyltransferase activity by impeding the binding to its substrate histone H3, resulting in a decrease of lysine 27 trimethylation and derepression of silenced genes, thus promotes cell proliferation and tumorigenicity. Our results also show that histone methylation is not permanent but regulated in a dynamic manner and that the Akt signaling pathway is involved in the regulation of this epigenetic modification through phosphorylation of EZH2, thus contributing to oncogenic processes. ^

Human placental lactogen enhancer: Tissue specificity and binding with specific proteins

Human placental lactogen (hPL) is a 22,000 dalton protein hormone produced in the placenta. The physiological actions of hPL are not well understood but its major activity is to regulate both maternal and fetal metabolism. hPL stimulates maternal lipolysis increasing free fatty acids in the maternal blood, allowing their use as an energy source by the mother, and sparing glucose for the fetus. It may also act as a growth promoting hormone for the fetus. hPL is produced in increasing amounts as pregnancy progresses. At term, hPL accounts for 10% of protein and 5% of total RNA in the placenta. This high level of hPL production is tissue-specific, as hPL is only produced in the placenta by syncytiotrophoblast cells.^ The objective of this work was to understand the mechanism by which such high levels of hPL are produced in a tissue-specific manner. A transcriptional enhancer found 2.2 kb 3$\sp\prime$ to one of the hPL genes (hPL$\sb3$) may explain the regulation of hPL expression. Transient transfection experiments using the hPL-producing human choriocarcinoma cell line JEG-3 localized the hPL enhancer to a 138 bp core element. This 138 bp sequence was found to be tissue specific in its actions as it did not promote transcription in heterologous cell lines. Gel mobility shift assays showed the hPL enhancer interacts specifically with nuclear proteins unique to hPL-producing cells. Within the 138 bp enhancer a 22 bp region was shown to be protected from DNase I digestion due to binding of proteins derived from placental nuclear extracts. Proteins binding this region of the enhancer may be instrumental in the tissue specific activity of the hPL enhancer. ^

A reduced model clarifies the role of feedback loops and time delays in the Drosophila circadian oscillator.

Although several detailed models of molecular processes essential for circadian oscillations have been developed, their complexity makes intuitive understanding of the oscillation mechanism difficult. The goal of the present study was to reduce a previously developed, detailed model to a minimal representation of the transcriptional regulation essential for circadian rhythmicity in Drosophila. The reduced model contains only two differential equations, each with time delays. A negative feedback loop is included, in which PER protein represses per transcription by binding the dCLOCK transcription factor. A positive feedback loop is also included, in which dCLOCK indirectly enhances its own formation. The model simulated circadian oscillations, light entrainment, and a phase-response curve with qualitative similarities to experiment. Time delays were found to be essential for simulation of circadian oscillations with this model. To examine the robustness of the simplified model to fluctuations in molecule numbers, a stochastic variant was constructed. Robust circadian oscillations and entrainment to light pulses were simulated with fewer than 80 molecules of each gene product present on average. Circadian oscillations persisted when the positive feedback loop was removed. Moreover, elimination of positive feedback did not decrease the robustness of oscillations to stochastic fluctuations or to variations in parameter values. Such reduced models can aid understanding of the oscillation mechanisms in Drosophila and in other organisms in which feedback regulation of transcription may play an important role.

ANKRD1, the gene encoding cardiac ankyrin repeat protein, is a novel dilated cardiomyopathy gene.

OBJECTIVES: We evaluated ankyrin repeat domain 1 (ANKRD1), the gene encoding cardiac ankyrin repeat protein (CARP), as a novel candidate gene for dilated cardiomyopathy (DCM) through mutation analysis of a cohort of familial or idiopathic DCM patients, based on the hypothesis that inherited dysfunction of mechanical stretch-based signaling is present in a subset of DCM patients. BACKGROUND: CARP, a transcription coinhibitor, is a member of the titin-N2A mechanosensory complex and translocates to the nucleus in response to stretch. It is up-regulated in cardiac failure and hypertrophy and represses expression of sarcomeric proteins. Its overexpression results in contractile dysfunction. METHODS: In all, 208 DCM patients were screened for mutations/variants in the coding region of ANKRD1 using polymerase chain reaction, denaturing high-performance liquid chromatography, and direct deoxyribonucleic acid sequencing. In vitro functional analyses of the mutation were performed using yeast 2-hybrid assays and investigating the effect on stretch-mediated gene expression in myoblastoid cell lines using quantitative real-time reverse transcription-polymerase chain reaction. RESULTS: Three missense heterozygous ANKRD1 mutations (P105S, V107L, and M184I) were identified in 4 DCM patients. The M184I mutation results in loss of CARP binding with Talin 1 and FHL2, and the P105S mutation in loss of Talin 1 binding. Intracellular localization of mutant CARP proteins is not altered. The mutations result in differential stretch-induced gene expression compared with wild-type CARP. CONCLUSIONS: ANKRD1 is a novel DCM gene, with mutations present in 1.9% of DCM patients. The ANKRD1 mutations may cause DCM as a result of disruption of the normal cardiac stretch-based signaling.

Cyan fluorescent protein expression in ganglion and amacrine cells in a thy1-CFP transgenic mouse retina.

PURPOSE: To characterize cyan fluorescent protein (CFP) expression in the retina of the thy1-CFP (B6.Cg-Tg(Thy1-CFP)23Jrs/J) transgenic mouse line. METHODS: CFP expression was characterized using morphometric methods and immunohistochemistry with antibodies to neurofilament light (NF-L), neuronal nuclei (NeuN), POU-domain protein (Brn3a) and calretinin, which immunolabel ganglion cells, and syntaxin 1 (HPC-1), glutamate decarboxylase 67 (GAD(67)), GABA plasma membrane transporter-1 (GAT-1), and choline acetyltransferase (ChAT), which immunolabel amacrine cells. RESULTS: CFP was extensively expressed in the inner retina, primarily in the inner plexiform layer (IPL), ganglion cell layer (GCL), nerve fiber layer, and optic nerve. CFP fluorescent cell bodies were in all retinal regions and their processes ramified in all laminae of the IPL. Some small, weakly CFP fluorescent somata were in the inner nuclear layer (INL). CFP-containing somata in the GCL ranged from 6 to 20 microm in diameter, and they had a density of 2636+/-347 cells/mm2 at 1.5 mm from the optic nerve head. Immunohistochemical studies demonstrated colocalization of CFP with the ganglion cell markers NF-L, NeuN, Brn3a, and calretinin. Immunohistochemistry with antibodies to HPC-1, GAD(67), GAT-1, and ChAT indicated that the small, weakly fluorescent CFP cells in the INL and GCL were cholinergic amacrine cells. CONCLUSIONS: The total number and density of CFP-fluorescent cells in the GCL were within the range of previous estimates of the total number of ganglion cells in the C57BL/6J line. Together these findings suggest that most ganglion cells in the thy1-CFP mouse line 23 express CFP. In conclusion, the thy1-CFP mouse line is highly useful for studies requiring the identification of ganglion cells.

Aldosterone-induced Sgk1 relieves Dot1a-Af9-mediated transcriptional repression of epithelial Na+ channel alpha.

Aldosterone plays a major role in the regulation of salt balance and the pathophysiology of cardiovascular and renal diseases. Many aldosterone-regulated genes--including that encoding the epithelial Na+ channel (ENaC), a key arbiter of Na+ transport in the kidney and other epithelia--have been identified, but the mechanisms by which the hormone modifies chromatin structure and thus transcription remain unknown. We previously described the basal repression of ENaCalpha by a complex containing the histone H3 Lys79 methyltransferase disruptor of telomeric silencing alternative splice variant a (Dot1a) and the putative transcription factor ALL1-fused gene from chromosome 9 (Af9) as well as the release of this repression by aldosterone treatment. Here we provide evidence from renal collecting duct cells and serum- and glucocorticoid-induced kinase-1 (Sgk1) WT and knockout mice that Sgk1 phosphorylated Af9, thereby impairing the Dot1a-Af9 interaction and leading to targeted histone H3 Lys79 hypomethylation at the ENaCalpha promoter and derepression of ENaCalpha transcription. Thus, Af9 is a physiologic target of Sgk1, and Sgk1 negatively regulates the Dot1a-Af9 repressor complex that controls transcription of ENaCalpha and likely other aldosterone-induced genes.

Computational identification and functional validation of regulatory motifs in cartilage-expressed genes.

Chondrocyte gene regulation is important for the generation and maintenance of cartilage tissues. Several regulatory factors have been identified that play a role in chondrogenesis, including the positive transacting factors of the SOX family such as SOX9, SOX5, and SOX6, as well as negative transacting factors such as C/EBP and delta EF1. However, a complete understanding of the intricate regulatory network that governs the tissue-specific expression of cartilage genes is not yet available. We have taken a computational approach to identify cis-regulatory, transcription factor (TF) binding motifs in a set of cartilage characteristic genes to better define the transcriptional regulatory networks that regulate chondrogenesis. Our computational methods have identified several TFs, whose binding profiles are available in the TRANSFAC database, as important to chondrogenesis. In addition, a cartilage-specific SOX-binding profile was constructed and used to identify both known, and novel, functional paired SOX-binding motifs in chondrocyte genes. Using DNA pattern-recognition algorithms, we have also identified cis-regulatory elements for unknown TFs. We have validated our computational predictions through mutational analyses in cell transfection experiments. One novel regulatory motif, N1, found at high frequency in the COL2A1 promoter, was found to bind to chondrocyte nuclear proteins. Mutational analyses suggest that this motif binds a repressive factor that regulates basal levels of the COL2A1 promoter.

Wingless activity in the precursor cells specifies neuronal migratory behavior in the Drosophila nerve cord.

Neurons and their precursor cells are formed in different regions within the developing CNS, but they migrate and occupy very specific sites in the mature CNS. The ultimate position of neurons is crucial for establishing proper synaptic connectivity in the brain. In Drosophila, despite its extensive use as a model system to study neurogenesis, we know almost nothing about neuronal migration or its regulation. In this paper, I show that one of the most studied neuronal pairs in the Drosophila nerve cord, RP2/sib, has a complicated migratory route. Based on my studies on Wingless (Wg) signaling, I report that the neuronal migratory pattern is determined at the precursor cell stage level. The results show that Wg activity in the precursor neuroectodermal and neuroblast levels specify neuronal migratory pattern two divisions later, thus, well ahead of the actual migratory event. Moreover, at least two downstream genes, Cut and Zfh1, are involved in this process but their role is at the downstream neuronal level. The functional importance of normal neuronal migration and the requirement of Wg signaling for the process are indicated by the finding that mislocated RP2 neurons in embryos mutant for Wg-signaling fail to properly send out their axon projection.

Analysis of a human placental lactogen gene promoter

Human placental lactogen (hPL) and human growth hormone (hGH) comprise a multigene family that share $>$90% nucleic acid sequence homology including 500 bp of 5$\sp\prime$ flanking sequence. Despite these similarities, hGH is produced in the anterior pituitary while hPL is expressed in the placenta. For most genes studied to date, regulation of expression occurs by alterations at the level of transcriptional initiation. Nuclear proteins bind specific DNA sequences in the promoter to regulate gene expression. In this study, the hPL$\sb3$ promoter was analyzed for DNA sequences that contribute to its expression. The interaction between the hPL$\sb3$ promoter and nuclear proteins was examined using nuclear extracts from placental and non-placental cells.^ To identify regulatory elements in the promoter of the hPL$\sb3$ gene, 5$\sp\prime$ deletion mutants were constructed by cleaving 1200 bp of upstream sequence with various restriction enzymes. These DNA fragments were ligated 5$\sp\prime$ to a promoterless bacterial gene chloramphenicol acetyltransferase (CAT) and transfected into JEG-3 cells, a human placental choriocarcinoma cell line. The level of CAT activity reflects the ability of the promoter mutants to activate transcription. Deletion of the sequence between $-$142 bp and $-$129 bp, relative to the start of transcription, resulted in an 8-fold decrease in CAT activity. Nuclear proteins from JEG-3, HeLa, and HepG2 (human liver cells), formed specific binding complexes with this region of the hPL$\sb3$ promoter, as shown by gel mobility shift assay. The $-$142 bp to $-$129 bp region contains a sequence similar to that of a variant binding site for the transcription factor Sp1. Sp1-like proteins were identified by DNA binding assay, in the nuclear extracts of the three cell lines. A series of G nucleotides in the hPL$\sb3$ promoter regulatory region were identified by methylation interference assay to interact with the DNA-binding proteins and the pattern obtained is similar to that for other Sp1 binding sites that have been studied. This suggests that hPL$\sb3$ may be transcriptionally regulated by Sp1 or a Sp1-like transacting factor. ^

Transcriptional regulation of the invariant chain associated with MHC class II molecules

The invariant chain associated with the major histocompatibility complex (MHC) class II molecules is a non-polymorphic glycoprotein implicated in antigen processing and class II molecule intracellular transport. Class II molecules and invariant chain (In) are expressed primarily by B lymphocytes and antigen-presenting cells such as macrophages and can be induced by interferon gamma (IFN-$\gamma$) in a variety of cell types such as endothelial cells, fibroblasts, and astrocytes. In this study the cis-acting sequences involved in the constitutive, tissue-specific, and IFN-$\gamma$ induced expression of the human In gene were investigated and nuclear proteins which specifically bound these sequences were identified.^ To define promoter sequences involved in the regulation of the human In gene, 790 bp 5$\sp\prime$ to the initiation of transcription were subcloned upstream of the gene encoding chloramphenicol acetyl transferase (CAT). Transfection of this construct into In expressing and non-expressing cell lines demonstrated that this 790 bp In promoter sequence conferred tissue specificity to the CAT gene. Deletion mutants were created in the promoter to identify sequences important for transcription. Three regulatory regions were identified $-$396 to $-$241, $-$241 to $-$216, and $-$216 to $-$165 bp 5$\sp\prime$ to the cap site. Transfection into a human glioblastoma cell line, U-373 MG, and treatment with IFN-$\gamma$, demonstrated that this 5$\sp\prime$ region is responsive to IFN-$\gamma$. An IFN-$\gamma$ response element was sublocalized to the region $-$120 to $-$61 bp. This region contains homology to the interferon-stimulated response element (ISRE) identified in other IFN responsive genes. IFN-$\gamma$ induces a sequence-specific DNA binding factor which binds to an oligonucleotide corresponding to $-$107 to $-$79 bp of the In promoter. This factor also binds to an oligonucleotide corresponding to $-$91 to $-$62 of the interferon-$\beta$ gene promoter, suggesting this factor may be member of the IRF-1/ISGF2, IRF-2, ICSBP family of ISRE binding proteins. A transcriptional enhancer was identified in the first intron of the In gene. This element, located in a 2.6 kb BamHI/PstI fragment, enhances the IFN-$\gamma$ response of the promoter in U-373 MG. The majority of the In enhancer activity was sublocalized to a 550 bp region $\sim$1.6 kb downstream of the In transcriptional start site. ^

The effect of v-{\it mos\/} expression on the regulation of the {\it fos\/} promoter in 490N3T cells

The v-mos oncogene acquired by Moloney murine sarcoma viruses by recombination with the c-mos proto-oncogene encodes a 37kD cytoplasmic serine/threonine protein kinase which can phosphorylate tubulin and vimentin, as well as the cyclin B component of the maturation promotion factor complex (MPF). Our earliest experiments asked whether the v-mos protein could activate the transcription of transin. Since the transcription of transin was known to be mediated by both fos-dependent and fos-independent pathways, it seemed possible that the induction of transin transcription by v-mos might be mediated by p55$\sp{\rm c-}\sp{fos}$. Surprisingly, when we examined the effect of v-mos on the fos promoter, we observed a significant inhibition of transcription in 49ON3T cells, a subclone of N1H3T3 mouse fibroblasts.^ In this thesis we show that in mouse 49ON3T cells, transcription from the fos promoter is up to 10-fold repressed in the presence of v-mos. Moreover, in this cell line several other transforming constructs (v-ras, v-src, neu) also cause repression of the fos promoter. Interestingly, nontransforming oncogenes (e.g. myc) do not repress fos transcription. The repressive effect was lost in v-mos mutants lacking in ATP-binding or kinase domain, arguing that the effect on fos transcription was mediated by v-mos transforming kinase activity. As mos is a cytoplasmic protein, it was assumed that transcriptional repression was mediated by conversion of a transcriptional regulator to a repressor by mos-induced phosphorylation. As a first approximation of the identity of this factor, we mapped the position of the mos effect on the fos promoter using reporter (CAT) constructs. We found that repression was mediated by regions $-$221 to $-$106 and $-$122 to $-$65 relative to the fos transcriptional start site, both of which regions regulate baseline fos transcription. There are direct repeats containing E2F transcriptional activator/repressor recognition motifs in these regions which bind similar nuclear proteins independently of v-mos presence or absence. Our data show that the contribution of the direct repeat to baseline fos transcription is mediated by these E2F sites with perhaps some contribution from the overlapping retinoblastoma control element (RCE). We have shown that there is a separate DNA protein interaction in the direct repeat which is more pronounced in the presence of v-mos. The recognition site for this protein, which we speculate mediates the mos-induced downregulation of fos transcription, overlaps but is distinct from the E2F and RCE binding sites. (Abstract shortened by UMI.) ^

Molecular mechanisms of chondrocyte-specific expression on the mouse pro$\alpha$1(II) collagen gene

Type II collagen is a major chondrocyte-specific component of the cartilage extracellular matrix and it represents a typical differentiation marker of mature chondrocytes. In order to delineate cis-acting elements of the mouse pro$\alpha1$(II) collagen gene that control chondrocyte-specific expression in intact mouse embryos, we generated transgenic mice harboring chimeric constructions in which varying lengths of the promoter and intron 1 sequences were linked to a $\beta$-galactosidase reporter gene. A construction containing a 3000-bp promoter and a 3020-bp intron 1 fragment directed high levels of $\beta$-galactosidase expression specifically to chondrocytes. Successive deletions of intron 1 delineated a 48-bp fragment which targeted $\beta$-galactosidase expression to chondrocytes with the same specificity as the larger intron 1 fragment. When the Col2a1 promoter was replaced with a minimal $\beta$-globin promoter, the 48-bp intron 1 sequence was still able to target expression of the transgene to chondrocytes, specifically. Therefore a 48-bp intron 1 DNA segment of the mouse Col2a1 gene contains the necessary information to confer high-level, temporally correct, chondrocyte expression to a reporter gene in intact mouse embryos and that Col2a1 promoter sequences are dispensable for chondrocyte expression. Nuclear proteins present selectively in mouse primary chondrocytes and rat chondrosarcoma cells bind to the three putative HMG (High-Mobility-Group) domain protein binding sites in this 48-bp sequence and the chondrocyte-specific proteins likely bind the DNA through minor groove. Together, my results indicate that a 48-bp sequence in Col2a1 intron 1 controls chondrocyte-specific expression in vivo and suggest that chondrocytes contain specific nuclear proteins involved in enhancer activity. ^

The effects of DNA cytosine methylation on H -ras promoter structure and function

The effect of DNA cytosine methylation on H-ras promoter activity was assessed using a transient expression system employing the plasmid H-rasCAT (NaeI H-ras promoter linked to the chloramphenicol acetyltransferase (CAT) gene). This 551 bp promoter is 80% GC rich, enriched with 168 CpG dinucleotides, and contains six functional GC box elements which represent major DNA methylation target sites. Prokaryotic methyltransferases HhaI (CGm$\sp5$CG) and HpaII (Cm$\sp5$CGG) alone or in combination with a human placental methyltransferase (HP MTase) were used to introduce methyl groups at different CpG sites within the promoter. To test for functional promoter activity, the methylated plasmids were introduced into CV-1 cells and CAT activity assessed 48 h post-transfection. Methylation at specific HhaI and HpaII sites reduced CAT expression by 70%, whereas more extensive methylation at generalized CpG sites with HP MTase inactivated the promoter $>$95%. The inhibition of H-ras promoter activity was not attributable to methylation-induced differences in DNA uptake or stability in the cell, topological form of the plasmid, or methylation effects in nonpromoter regions. We also observed that DNA cytosine methylation of a 360 bp promoter fragment by HP MTase induced a local change in DNA conformation. Using three independent methodologies (nitrocellulose filter binding assays, gel mobility shifts, and Southwestern blots), we determined that this change in promoter conformation affected the interaction of nuclear proteins with cis-regulatory sequences residing in the promoter region. The results provide evidence to suggest that DNA methylation may regulate gene expression by inducing changes in local promoter conformation which in turn alters the interactions between DNA and protein factors required for transcription. The results provide supportive evidence for the hypothesis of Cedar and Riggs, who postulated that DNA methylation may regulate gene expression by altering the binding affinities of proteins for DNA. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^